cloning gene specific guide rna sequences (Addgene inc)
Addgene inc is a verified supplier 
93
Structured Review
Addgene inc
cloning gene specific guide rna sequences
Cloning Gene Specific Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/gRNA+Cloning+Vector+Bbs+I+ver%2E+2+(Plasmid+%2385586)/pmc11494886-326-6-16
Average 93 stars, based on 10 article reviews
Cloning Gene Specific Guide Rna Sequences, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/grna-2+sequence/gRNA+Cloning+Vector+Bbs+I+ver%2E+2+(Plasmid+%2385586)/pmc11494886-326-6-16
Average 93 stars, based on 10 article reviews
cloning gene specific guide rna sequences - by Bioz Stars,
2026-09
93/100 stars
Images
Related Articles
Sequencing:Article Title: Evaluation of a Novel Oncolytic Adenovirus Silencing SYVN1 Article Snippet: .. A549/PG13-Luc.cl9 cells were co-transfected with pX330-Delta_Puro [ ] in which Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells Article Snippet: pADHS8: pU6-GCN2-2-Cas9-2A-GFP , Cloned from Ran et al., 2013 , Cloned GCN2 (EIF2AK4) guide RNA sequence 3 (Doench et al. 2016, Addgene #75877) into pSpCas9(BB)-2A-GFP (PX458). .. pADHS9: pU6-EEF2K-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned Article Title: An aggregon in conductin/axin2 regulates Wnt/β-catenin signaling and holds potential for cancer therapy Article Snippet: .. In short, a top scoring guide RNA according to the CRISPR Design tool provided by the Zhang Lab (crispr.mit.edu) targeting exon 2 of Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells Article Snippet: pADHS6: pSpCas9(BB)-2A-GFP (PX458) , Ran et al., 2013 , Addgene #48138. .. pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned Plasmid Preparation:Article Title: Evaluation of a Novel Oncolytic Adenovirus Silencing SYVN1 Article Snippet: .. A549/PG13-Luc.cl9 cells were co-transfected with pX330-Delta_Puro [ ] in which Article Title: KBG syndrome-associated protein ANKRD11 regulates SETD5 expression to modulate rRNA levels and translation Article Snippet: pSpCas9(BB)-2A-puro , Addgene , Addgene Plasmid #48139. .. pSpCas9( CRISPR:Article Title: Discovery and design of molecular glue enhancers of CDK12–DDB1 interactions for targeted degradation of cyclin K Article Snippet: .. CRISPR knockout plasmids were created by Article Title: An aggregon in conductin/axin2 regulates Wnt/β-catenin signaling and holds potential for cancer therapy Article Snippet: .. In short, a top scoring guide RNA according to the CRISPR Design tool provided by the Zhang Lab (crispr.mit.edu) targeting exon 2 of Knock-Out:Article Title: Discovery and design of molecular glue enhancers of CDK12–DDB1 interactions for targeted degradation of cyclin K Article Snippet: .. CRISPR knockout plasmids were created by Cloning:Article Title: Discovery and design of molecular glue enhancers of CDK12–DDB1 interactions for targeted degradation of cyclin K Article Snippet: .. CRISPR knockout plasmids were created by Clone Assay:Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells Article Snippet: pADHS8: pU6-GCN2-2-Cas9-2A-GFP , Cloned from Ran et al., 2013 , Cloned GCN2 (EIF2AK4) guide RNA sequence 3 (Doench et al. 2016, Addgene #75877) into pSpCas9(BB)-2A-GFP (PX458). .. pADHS9: pU6-EEF2K-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned Article Title: An aggregon in conductin/axin2 regulates Wnt/β-catenin signaling and holds potential for cancer therapy Article Snippet: .. In short, a top scoring guide RNA according to the CRISPR Design tool provided by the Zhang Lab (crispr.mit.edu) targeting exon 2 of Article Title: Translational control through differential ribosome pausing during amino acid limitation in mammalian cells Article Snippet: pADHS6: pSpCas9(BB)-2A-GFP (PX458) , Ran et al., 2013 , Addgene #48138. .. pADHS7: pU6-GCN2-1-Cas9-2A-BFP , Cloned from Chu et al., 2015 , Cloned Article Title: Selective use of primate CD4 receptors by HIV-1. Article Snippet: .. The other:Article Title: Barcoding of small extracellular vesicles with CRISPR-gRNA enables comprehensive, subpopulation-specific analysis of their biogenesis and release regulators Article Snippet: This work pKK209 Constitutive expression of BFP-targeting gRNA (gRNA #2) (spacer sequence; GCACATGAAGCTGTACATGG). oKK531 and oKK532 were inserted to Amplification:Article Title: Selective use of primate CD4 receptors by HIV-1. Article Snippet: .. The Polymerase Chain Reaction:Article Title: Selective use of primate CD4 receptors by HIV-1. Article Snippet: .. The |
